GENET archive

[Index][Thread]

2-Plants: GE rice produced for vitamin-A supplementation



-------------------------- GENET-news ---------------------------

TITLE:  Engineering the provitamin A (b-carotene) biosynthetic
        pathway into (carotenoid-free) rice endosperm
SOURCE: Scinece, Vol 287, by X. Ye et al.
DATE:   January 14, 2000

----------------- archive: http://www.gene.ch/ ------------------


Engineering the provitamin A (b-carotene) biosynthetic pathway
into (carotenoid-free) rice endosperm

Xudong Ye, 1 *İ Salim Al-Babili, 2 * Andreas Kloeti, 1 ı Jing
Zhang, 1 Paola Lucca, 1 Peter Beyer, 2 § Ingo Potrykus 1 §

1 Institute for Plant Sciences, Swiss Federal Institute of
Technology, CH-8092 Zurich, Switzerland. 2 University of
Freiburg, Center for Applied Biosciences, D-79104 Freiburg,
Germany.

*These authors contributed equally to this work. İPresent
address: Agracetus Monsanto, 8520 University Green, Middleton, WI
53562, USA. ıPresent address: Paradigm Genetics, 104 Alexander
Drive, Research Triangle Park, NC 27709­4528, USA. §To whom
correspondence should be addressed. E- mail: beyer@uni
freiburg.de (P.B.) and ingo.potrykus@ ipw.biol.ethz.ch (I.P.)

Rice (Oryza sativa), a major staple food, is usually milled to
remove the oil-rich aleurone layer that turns rancid upon
storage, especially in tropical areas. The remaining edible part
of rice grains, the endosperm, lacks several essential nutrients,
such as provitamin A. Thus, predominant rice consumption promotes
vitamin A deŞciency, a serious public health problem in at least
26 countries, including highly populated areas of Asia, Africa,
and Latin America. Recombinant DNA technology was used to improve
its nutritional value in this respect. A combination of trans
genes enabled biosynthesis of provitamin A in the endosperm.

Vitamin A deficiency causes symptoms ranging from night blindness
to those of xerophthalmia and keratomalacia, leading to total
blindness. In Southeast Asia, it is estimated that a quarter of a
million children go blind each year because of this nutritional
deficiency (1). Furthermore, vitamin A deficiency exacerbates
afflictions such as diarrhea, respiratory diseases, and childhood
diseases such as measles (2, 3). It is estimated that 124 million
children worldwide are deficient in vitamin A (4) and that
improved nutrition could prevent 1 million to 2 million deaths
annually among children (3). Oral delivery of vitamin A is
problematic (5, 6), mainly due to the lack of infrastructure, so
alternatives are urgently required. Success might be found in
supplementation of a major staple food, rice, with provitamin A.
Because no rice cultivars produce this provitamin in the
endosperm, recombinant technologies rather than conventional
breeding are required.

Immature rice endosperm is capable of synthesizing the early
intermediate geranylgeranyl diphosphate, which can be used to
produce the uncolored carotene phytoene by expressing the enzyme
phytoene synthase in rice endosperm (7). The synthesis of b
carotene requires the complementation with three additional plant
enzymes: phytoene desaturase and z-carotene desaturase, each
catalyzing the introduction of two double bonds, and lycopene b
cyclase, encoded by the lcy gene. To reduce the transformation
effort, a bacterial carotene desaturase, capable of introducing
all four double bonds required, can be used.

We used Agrobacterium-mediated transformation to introduce the
entire b-carotene bio-synthetic pathway into rice endosperm in a
single transformation effort with three vectors (Fig. 1) (8). The
vector pB19hpc combines the sequences for a plant phytoene
synthase ( psy) originating from daffodil (9)(Narcissus
pseudonarcissus; GenBank accession number X78814) with the
sequence coding for a bacterial phytoene desaturase (crtI )
originating from Erwinia uredovora (GenBank accession number
D90087) placed under control of the endosperm-specific glutelin
(Gt1) and the constitutive CaMV (cauliflower mosaic virus) 35S
promoter, respectively. The phytoene synthase cDNA contained a
59-sequence coding for a functional transit peptide (10), and the
crtI gene contained the transit peptide (tp) sequence of the pea
Rubisco small subunit (11). This plasmid should direct the
formation of lycopene in the endosperm plastids, the site of
geranylgeranyldiphosphate formation.

To complete the b-carotene biosynthetic pathway, we co
transformed with vectors pZPsC and pZLcyH. Vector pZPsC carries
psy and crtI, as in plasmid pB19hpc, but lacks the selectable
marker aphIV expression cassette. Vector pZLcyH provides lycopene
b-cyclase from Narcissus pseudonarcissus (12) (Gen-Bank accession
number X98796) controlled by rice glutelin promoter and the aphIV
gene controlled by the CaMV 35S promoter as a selectable marker.
Lycopene b-cyclase carried a functional transit peptide allowing
plastid import (10).

Precultured immature rice embryos (n 5 800) were inoculated with
Agrobacterium LBA4404/pB19hpc. Hygromycin-resistant plants (n 5
50) were analyzed for the presence of psy and crtI genes (Fig.
2). Meganuclease I­Sce I digestion released the; 10-kb insertion
containing the aphIV, psy, and crtI ex-pression cassettes. Kpn I
was used to estimate the insertion copy number. All samples
analyzed carried the transgenes and revealed mostly single
insertions.

Immature rice embryos (n 5 500) were inoculated with a mixture of
Agrobacterium LBA4404/pZPsC and LBA4404/pZLcyH. Co-transformed
plants were identified by Southern hybridization, and the
presence of pZPsC was analyzed by restriction digestion. Presence
of the pZLcyH expression cassettes was determined by probing I
Sce I­ and Spe I­digested genomic DNA with internal lcy
fragments. Of 60 randomly selected regenerated lines, all were
positive for lcy and 12 contained pZPsC as shown by the presence
of the expected fragments: 6.6 kb for the I-Sce I­excised psy and
crtI expression cassettes from pZPsC and 9.5 kb for the lcy and
aphIV genes from pZCycH (Fig. 1). One to three transgene copies
were found in co-transformed plants. Ten plants harboring all
four introduced genes were transferred into the greenhouse for
setting seeds. All transformed plants described here showed a
normal vegetative phenotype and were fertile.

Mature seeds from T 0 transgenic lines and from control plants
were air dried, dehusked, and, in order to isolate the endosperm,
polished with emery paper. In most cases, the transformed
endosperms were yellow, indicating carotenoid formation. The
pB19hpc single transformants (Fig. 2A) showed a 3:1 (colored
noncolored) segregation pattern, whereas the pZPsC/pZLcyH co
transformants (Fig. 2B) showed variable segregation. The pB19hpc
single transformants, engineered to synthesize only lycopene
(red), were similar in color to the pZPsC/pZLcyH co-transformants
engineered for b-carotene (yellow) synthesis.

Seeds from individual lines (1 g for each line) were analyzed for
carotenoids by photometric and by high-performance liquid
chromatography (HPLC) analyses (13). The carotenoids found in the
pB19hpc single transformants accounted for the color; none of
these lines accumulated detectable amounts of lycopene. Instead,
b-carotene, and to some extent lutein and zeaxanthin, were formed
(Fig. 3). Thus, the lycopene a(e)- and b-cyclases and the
hydroxylase are either constitutively expressed in normal rice
endosperm or induced upon lycopene formation.

The pZPsC/pZLcyH co-transformants had a more variable carotenoid
pattern ranging from phenotypes similar to those from single
transformations to others that contain b-carotene as almost the
only carotenoid. Line z11b is such an example (Fig. 3C and Fig.
2B, panel 2) with 1.6 mg/g carotenoid in the endosperm. However,
reliable quantitations must await homozygous lines with uniformly
colored grains. Considering that extracts from the sum of
(colored/noncolored) segregating grains were analyzed, the goal
of providing at least 2 mg/g provitamin A in homozygous lines
(corresponding to 100 mg retinol equivalents at a daily intake of
300 g of rice per day), seems to be realistic (7). It is not yet
clear whether lines producing provitamin A (b-carotene) or lines
possessing additionally zeaxanthin and lutein would be more
nutritious, because the latter have been implicated in the
maintenance of a healthy macula within the retina (14).

References and Notes

1. A. Sommer, J. Nutr. 119, 96 (1988).
2. J. P. Grant, The State of the World¹s Children (Oxford Univ.
Press, Oxford, 1991).
3. K. P. West Jr., G. R. Howard, A. Sommer, Annu. Rev. Nutr. 9,
63 (1989).
4. J. H. Humphrey, K. P. West Jr., A. Sommer, WHO Bull. 70, 225
(1992).
5. A. Pirie, Proc. Nutr. Soc. 42, 53 (1983).
6. A. Sommer, in Elevated Dosages of Vitamins: BeneŞts and
Hazards, P. Walter, G. Brubacher, H. Staehelin, Eds. (Hans Huber,
Toronto, Canada, 1989), pp. 37­41.
7. P. Burkhardt et al., Plant J. 11, 1071 (1997).
8. Three vectors ‹ pUC18, pPZP100, and pBin19 (15­17) ‹ were
digested with Eco RI and Hind III and a synthetic linker şanking
by meganuclease I­Sce I including Kpn I, Not I, and Sma I (59
AATTCATTACCCTGTTATCCCTACCCGGGCGGCCGCGGTACCATTACCCTGTTA TCCCTAA
39) and (59-AGCTTTAGGGATAACA
GGGTAATGGTACCGCGGCCGCCCGGGTAGGGATAACGGGTAATG-39) were introduced,
forming pUC18M, pPZP100M, and pBin19M, respectively. An
intermediate vector was made by insertion of the crtI expression
cassette excised from Hind III/Eco RI­digested pUCET4, originally
derived from pYPIET4 (11), into pBluescriptKS with Hind III/Eco
RI digestion, followed by insertion of psy expression cassette
from Sac II­blunted/Kpn I­digested pGt1psyH (7) into the Kpn I
Xho I­blunted previous vector. Finally, crtI and psy expression
cassettes were isolated with Kpn I/Not I digestion and inserted
into Kpn I/Not I­digested pUC18M and designated as pBaal3.
pBin19hpc was made by insertion of a Kpn I fragment originally
from pCIB900 (18) containing aphIV selectable marker gene into
pBaal3, followed by digestion of the I-Sce I fragment of the
resulting plasmid and insertion into I-Sce I­digested pBin19M.
pZPsC was obtained by insertion of the I-SceI fragment of pBaal3
bearing the psy and crtI genes into I-Sce I­digested pPZP100M.
pZLcyH was construct ed by digestion of pGt1LcyH with I-Sce I and
insertion of the resulting fragment, carrying lcy and aphIV, into
I-Sce I­restricted pPZP100M. The three vectors were separately
electroporated into Agrobacterium tumefaciens LBA4404 (19) with
corresponding antibiotic selection. Callus induction: Immature
seeds of japonica rice cultivar TP 309 at milk stage were
collected from greenhouse-grown plants, surface-sterilized in 70%
ethanol (v/v) for 1 min, incubated in 6% calcium hypochloride for
1 hour on a shaker, and rinsed three to Şve times with sterile
distilled water. Immature embryos were then isolated from the
sterilized seeds and cultured onto NB medium [N6 salts and B5
vitamins, supplemented with 30 g/l maltose, 500 mg/l proline, 300
mg/l casein hydrolate, 500 mg/l glutamine, and 2 mg/l 2,4-D (pH
5.8)]. After 4 to 5 days, the coleoptiles were removed, and the
swelled scutella were subcultured onto fresh NB medium for 3 to 5
days until inoculation of Agrobacterium. Transforma tion: 1-week
old precultured immature embryos were immersed in Agrobacterium
tumefaciens LBA 4404 cell suspension as described (20). For co
transformation, LBA4404/pZPsC [optical density at 600 nm (OD 600
) 5 2.0] mixed with an equal volume of LBA4404/pZLcyH (OD 600 5
1.0) was used for inoculation after acetonsyrigone induction. The
inoculated precultured embryos were co-cultivated onto NB medium
supplemented with 200 mM acetonsyringone for 3 days, subcultured
on recovery medium (NB with 250 mg/l cefotaxime) for 1 week and
then transferred onto NB selection medium in the presence of 30
mg/l hygromycin and 250 mg/l cefotaxime for 4 to 6 weeks.
Transgenic plants were regenerated from recovered resistant calli
on NB medium supplemented with 0.5 mg/l NAA and 3 mg/l BAP in 4
weeks, rooted and transferred into the greenhouse.
9. M. Schledz et al., Plant J. 10, 781 (1996).
10. M. Bonk et al., Eur. J. Biochem. 247, 942 (1997).
11. N. Misawa et al., Plant J. 4, 833 (1993).
12. S. Al-Babili, E. Hobeika, P. Beyer, Plant Physiol. 112, 1398
(1996).
13. Dehusked seeds were polished for 6 hours with emery paper on
a shaker. The endosperm obtained was ground to a Şne powder and 1
g was extracted repeatedly with acetone. Combined extracts were
used to record the ultraviolet-visible spectrum, al lowing
quantiŞcation using E450nm 134,000 l ­1 mol ­1 cm ­1 for b
carotene. The samples were dried and the residue quantitatively
applied in 30 ml chloroform to HPLC for analysis using a
photodiode array detector (Waters) and a C 30 reversed-phase
column (YMC Europe GmbH) with the solvent system A [methanol:
tert-butylmethyl ether (1: 1, v/v)] and system B [methanol:tert
butylmethyl ether:H 2 O (6: 1.2 : 1.2, v/v/v)], using a gradient
of 100% B to 43% B within 25 min, then to 0% B within a further
75 min. Final conditions were maintained for an additional 10
min. Photometric quantiŞcations were re-examined by HPLC using
synthetic all-trans lycopene as an external standard.
14. J. T. Landrum et al., Exp. Eye Res. 65, 57 (1997).
15. C. Yanish-Perron, J. Vieira, J. C. Messing, Gene 33, 103
(1985).
16. P. Hajdukiewicz et al., Plant Mol. Biol. 25, 989 (1994).
17. M. Bevan, Nucleic Acids Res. 12, 8711 (1984).
18. J. Wuenn et al., Bio/Technology 14, 171 (1996).
19. A. Hoekema, P. R. Hirsch, P. J. J. Hooykaas, R. A.
Schilperoort, Nature 303, 179 (1983).
20. M. Uze et al., Plant Sci. 130, 87 (1997).
21. The crtI gene fused to the transit peptide sequence was
kindly provided by N. Misawa (Kirin Co., Ltd., Japan). We thank
W. Dong and P. Burkhardt for their valuable contributions, S.
Klarer, K. Konja, and U. Schneider-Ziebert for skillful technical
assistance, and R. Cassada for correcting the English version of
the manuscript. Supported by the Rockefeller Foundation (1993
1996), the European Community Biotech Program (FAIR CT96, 1996
1999) (P.B.), the Swiss Federal OfŞce for Education and Science
(I.P.) and by the Swiss Federal Institute of Technology (1993
1996).

15 July 1999; accepted 19 November 1999 


--

|*********************************************|
|                   GENET                     |
| European NGO Network on Genetic Engineering |
|                                             |
|             Hartmut MEYER (Mr)              |
|          Reinhaeuser Landstr. 51            |
|            D - 37083 Goettingen             |
|                 Germany                     |
|                                             |
| phone: +49-551-7700027                      |
| fax:   +49-551-7701672                      |
| email: genetnl@xs4all.be                    |
|*********************************************|